Review



cloning rab3c cds  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Addgene inc cloning rab3c cds
    Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, <t>Rab3C,</t> Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).
    Cloning Rab3c Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+rab3c+cds/pmc07907685-431-51-63?v=Addgene+inc
    Average 92 stars, based on 1 article reviews
    cloning rab3c cds - by Bioz Stars, 2026-07
    92/100 stars

    Images

    1) Product Images from "Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers"

    Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

    Journal: Developmental Cell

    doi: 10.1016/j.devcel.2021.01.010

    Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).
    Figure Legend Snippet: Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).

    Techniques Used: Expressing, Labeling


    Figure Legend Snippet:

    Techniques Used: Recombinant, Derivative Assay, shRNA, Sequencing, Mutagenesis, Plasmid Preparation, Software



    Similar Products

    cloning rab3c cds  (Addgene inc)
    92
    Addgene inc cloning rab3c cds
    Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, <t>Rab3C,</t> Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).
    Cloning Rab3c Cds, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cloning+rab3c+cds/pmc07907685-431-51-63?v=Addgene+inc
    Average 92 stars, based on 1 article reviews
    cloning rab3c cds - by Bioz Stars, 2026-07
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).

    Journal: Developmental Cell

    Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

    doi: 10.1016/j.devcel.2021.01.010

    Figure Lengend Snippet: Anterogradely transported RUSH-TrkB carriers are negative for Rab27B, Rab3C, Rab8A, and Rab11A (A–L) Neurons co-expressing RUSH-TrkB-GFP and labeled Rab proteins: (A–C) mRuby3-Rab27B, (D–F) mRuby3-Rab3C, (G–I) mRFP-Rab8A, and (J–L) mRFP-Rab11A. Neurons were live imaged in the soma area immediately after addition of biotin for 45 min at 1 frame/min (A, D, G, and J), and then we imaged for 5 min at 1 s/frame at the proximal axon during a time window of 45–90 min after addition of biotin (C, F, I, and L). Plots show RUSH-TrkB and Rab proteins intensities in the peri-nuclear Golgi region over time in representative neurons (B, E, H, and K). Kymographs of RUSH-TrkB-GFP and respective Rab proteins motility in individual axons (C, F, I, and L).

    Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by cloning Rab3C CDS (from in-house cloned GW1-GFP-Rab3C) and Rab27B CDS (from GFP-Rab27B, Addgene # 89447) into BglII/BamHI restricted mRuby3-Tubulin (Addgene # 74256); mRFP-Rab11A, mRFP-Rab8A was previously constructed in-house by inserting respective human Rab CDS into pGW1-mRFP backbone.

    Techniques: Expressing, Labeling

    Journal: Developmental Cell

    Article Title: Combined kinesin-1 and kinesin-3 activity drives axonal trafficking of TrkB receptors in Rab6 carriers

    doi: 10.1016/j.devcel.2021.01.010

    Figure Lengend Snippet:

    Article Snippet: GFP-Rab6A and mCherry-Rab6A were previously cloned in-house by inserting human Rab6A CDS into pGW2-GFP and pGW2-mCherry (modified pGW1) backbones. mCherry-Rab6A-Q72L and mCherry-Rab6A-T27N were constructed by site-directed mutagenesis of mCherry-Rab6A using circular PCR with the following primers: Q72L-Fw: ACAGCAGGTCTAGAGCGGTTC, Q72L-Rev: GTCCCATAATTGCAATCGTAC, T27N-Fw: GTTGGAAAGAACTCTTTGATCACCAGATTCATGTATGACAG and T27N-Rev: GCTTTGCTCCCCCAGGAA. mRuby3-Rab3C and mRuby3-Rab27B were constructed by cloning Rab3C CDS (from in-house cloned GW1-GFP-Rab3C) and Rab27B CDS (from GFP-Rab27B, Addgene # 89447) into BglII/BamHI restricted mRuby3-Tubulin (Addgene # 74256); mRFP-Rab11A, mRFP-Rab8A was previously constructed in-house by inserting respective human Rab CDS into pGW1-mRFP backbone.

    Techniques: Recombinant, Derivative Assay, shRNA, Sequencing, Mutagenesis, Plasmid Preparation, Software